16+
Горячая линия Горячая линия
8 (391) 226-89-50,

пн-чт 10-12 и 13-17,
пт 10-12 и 13-16

Доступ для сотрудников


Инструкция №6 от 03.05.2003


Лабораторная диагностика "Атипичной пневмонии" (SARS) методом ПЦР

3 Мая 2003

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ



У Т В Е Р Ж Д А Ю
Первый заместитель Министра
здравоохранения Российской Федерации,
Главный государственный санитарный врач
Российской Федерации.

Г.Г. Онищенко
3 мая 2003 г.

 

 

Временные методические рекомендации

2003 год     г.Москва

Аннотация

В настоящих методических рекомендациях приводятся правила организации и выполнения генодиагностических исследований при лабораторной диагностике синдрома острого респираторного заболевания (атипичной пневмонии - SARS). Рекомендации предназначены для специалистов научно-исследовательских противочумных институтов, противочумных станций и других учреждений, применяющих метод ПЦР для обнаружения ДНК возбудителей инфекционных заболеваний I-II групп патогенности.

РАЗРАБОТАНЫ:
Министерством здравоохранения Российской Федерации (Федоров Ю.М., Жилина Н.Я.)
Российским НИПЧИ "Микроб" (Кутырев В.В., Куличенко А.Н., Дроздов И.Г., Шарова И.Н., Осина Н.А., Гаранина С.Б., Ляпин М.Н.)
Вирусологическим центром НИИ микробиологии Минобороны России (Максимов В.А., Марков В.Н.)
ГНЦ вирусологии и биотехнологии «Вектор»(Терновой В.А., Рудзевич Т.Н., Максимов Н.Л., Игнатьев Г.М., Нетесов С.В.)

1.Введение

1.1. Настоящие методические рекомендации определяют временный порядок и правила проведения лабораторных исследований по специфической детекции РНК коронавирусов, вызывающих синдром острого респираторного заболевания, или атипичную пневмонию, или SARS (далее по тексту SARS) до завершения разработки и внедрения в практику диагностических препаратов к вирусу SARS.
1.2. Рекомендации разработаны для специалистов противочумных институтов, противочумных станций и других учреждений, осуществляющих лабораторную диагностику SARS, в соответствии с «Временной инструкцией по лабораторной диагностике синдрома острого респираторного заболевания (атипичной пневмонии) (SARS)» (письмо Первого заместителя Министра здравоохранения Российской Федерации от 21.04.03 г.).
1.3. Инкубационный период SARS составляет 2-14 суток, в среднем 7-10 суток, лихорадочный период – до 10-14 суток. РНК вируса методом ПЦР выявляют в биологических жидкостях: крови, мокроте, смывах носоглотки на 1-10 сутки заболевания.
1.4. В связи с существенными трудностями в культивировании и выделении коронавирусов, методы генодиагностики являются в настоящее время ведущими в подтверждении связи заболевания «атипичной пневмонией» с вирусом SARS. Принцип метода состоит в направленной амплификации кДНК, синтезируемой с помощью обратной транскриптазы, на основе специфичного фрагмента РНК вируса. С целью повышения достоверности анализа рекомендуется проведение ПЦР с двумя парами праймеров (используются раздельно).
1.5. В методических рекомендациях представлены протоколы ПЦР, основанные на рекомендациях ВОЗ, до появления первых случаях заболеваний «атипичной пневмонии» в России. Протоколы могут быть модифицированы в дальнейшем, по мере изменения ситуации.
1.6. В соответствии с «Временной инструкцией …» вирус SARS отнесён к II группе патогенности. С учётом отсутствия регламентированных методов инактивации вирусов при исследованиях проводимых методом ПЦР и доказанной высокой опасности заражения медицинского персонала вся работа проводится с тщательным соблюдением мер биобезопасности регламентированных СП 1.2.011-94 «Безопасность работы с микроорганизмами I-II групп патогенности» и СП 1.2.036-95 «Порядок учета, хранения, передачи и транспортирования микроорганизмов I-IV групп патогенности».

2. Отбор проб и транспортировка биологического материала

2.1. Отбор проб от больных и подозрительных на заражение вирусом SARS осуществляет медицинский персонал, с соблюдением правил противоэпидемического режима.
2.2. Материал для исследования методом ПЦР забирают в стерильные пробирки с герметично завинчивающимися крышками. Консервант (мертиолят натрия) не добавляется.
2.2.1. Кровь. Забор производят из локтевой вены в количестве 4,5 мл стерильным шприцем, в который предварительно вносят 0,5 мл стерильного 4 % раствора натрия цитрата и переносят в пробирку. Аккуратно перемешивают покачиванием.
2.2.2. Мазки и смывы с носоглотки, бронхоальвеолярные смывы, плевральную жидкость отбирают в количестве 5 мл. Мазки забирают тампонами и помещают в стерильные пробирки с 5 мл физиологического раствора. Не рекомендуется использовать тампоны на деревянной палочке, так как они могут содержать субстраты инактивирующие вирусы и ингибирующие ПЦР.
2.2.3. Секционный материал. Исследуют лёгкие, сегментарные бронхи, кровь, печень, селезёнку. Кусочки органов весом 5-10 г помещают в стерильные герметично закрывающиеся ёмкости.
2.2.5. Кровь, смывы с дыхательных путей хранят и транспортируют в лабораторию для исследований при температуре минус 20° С.

3. Организация работ при проведении исследований с использованием ПЦР

3.1. Исследования материала от больного подозрительного на заражённость вирусом SARS методом ПЦР проводят в учреждениях, имеющих разрешение на работу с ПБА I-II групп патогенности.
3.2. Для проведения генодиагностических исследований выделяют четыре отдельные комнаты, предназначенные для выполнения следующих этапов ПЦР-анализа:
а - первичная подготовка, выделение РНК и постановка реакции обратной транскрипции (синтез кДНК);
б – проведение ПЦР;
в - учет результатов реакции амплификации;
г - приготовление реакционных смесей для реакции обратной транскрипции и ПЦР (чистое помещение).
Комнаты «а», «б», «в» укомплектовываются емкостями с дезинфицирующим средством и баками для автоклавирования.
3.3. Помещение «а» должно быть оборудовано боксирующим устройством (боксом безопасности). В боксе размещают поддон с салфеткой, смоченной 6% раствором перекиси водорода, для разбора и первичной подготовки проб, оборудование для выделения РНК и проведения реакции обратной транскрипции: микроцентрифугу, вортекс, твердотельный термостат. В этой комнате находится низкотемпературный холодильник для хранения нативного материала. В помещении «б» расположен амплификатор для постановки ПЦР. В помещении «в» находится оборудование для проведения электрофореза, учета и документирования результатов (источник тока, камера для электрофореза, трансиллюминатор с устройством для документирования результатов электрофореза и поддон с салфеткой, смоченной 6 % раствором перекиси водорода.
3.4. Подготовку реакционных смесей (master mix) для реакции обратной транскрипции и ПЦР осуществляют в отдельном «чистом» помещении «г». Пробирки с приготовленными реактивами передают в комнаты «а» и «б» для внесения в них исследуемых проб.
3.5. Каждое помещение должно иметь свой набор, автоматических пипеток, наконечников (с фильтрами), пластиковой и стеклянной посуды, используемых только в данной комнате (боксе) и имеющих соответствующую маркировку. Наконечники должны строго соответствовать автоматическим пипеткам, пробирки для амплификации - термоциклерам (в соответствии с инструкцией фирмы-производителя прибора).
3.6. Аптечка дополнительно комплектуется: 1% раствором борной кислоты, интерфероном.

4. Рекомендуемые наборы реактивов, оборудование и расходные материалы.

4.1. Наборы реактивов.
- набор для выделения РНК «Рибо-сорб» (производство ЦНИИ эпидемиологии, г. Москва);
- набор для реакции обратной транскрипции "Реверта"; (производство ЦНИИ эпидемиологии, г. Москва);
- олигонуклеотидные праймеры (синтез осуществляет ООО «Синтол» г.Москва);
- маркеры молекулярного веса (производство ООО«Синтол» г.Москва)
4.2. Оборудование и расходные материалы для ПЦР (могут быть заменены на аналогичные по своим характеристикам)
- амплификатор (программируемый термоциклер) Терциктм МС 2 (ЗАО "ДНК-технология", Россия);
- малогабаритная высокоскоростная лабораторная микроцентрифуга "ЦиклоТемп – 201", 16000 об/мин, со сменными роторами для пробирок – 0,5 мл и 1,5/2,0 мл ( НПФ "СТМ-Ц", Россия);
- микроцентрифуга/встряхиватель ТЭТА 2 (ООО "Биоком", Россия);
- программируемый твердотельный термостат Т-2415 с диапазоном рабочих температур от 20° С до 120° С (ООО "Биоком", Россия);
- автоматические пипетки "Ленпипет" Россия 0,5-10, 5-40, 40-200, 200-1000 мкл;
- программируемый охладитель проб ОП-01 для пробирок 0,5 и 1,5 мл (ООО "Биоком", Россия);
- источник тока "Эльф-4" (ЗАО "ДНК-технология", Россия);
- миникамера для электрофореза SE-1 (ООО "Хеликон", Россия);
- УФ трансиллюминатор LKB 2011 ("LKB", Швеция);
- фотоаппарат с оранжевым или интерференциальным (594 нм) сфетофильтром или видиосистема для компьюторного документирования;
- микроцетрифужные пробирки объемом 0,6 мл (QSP, США);
- микроцентрифужные пробирки объемом 1,5 мл с завинчивающейся крышкой);
- наконечники для автоматических пипеток с фильтрами на 10, 200 и 1000 мкл (QSP, США).

5. Проведение анализа

5.1. Первичная подготовка проб.
Контейнер (герметичную тару, бикс) с доставленными на исследования пробами устанавливают в поддон, в бокс безопасности на 35-40 мин. Затем осторожно открывают крышку контейнера и, убедившись в целостности емкости(ей) с материалом, выставляют их на поддон предварительно обработав снаружи дезраствором. Емкости маркируют и регистрируют (лист регистрации выносят из «заразной» зоны только после обработки погружением в дезинфицирующий раствор).
5.2. Выделение РНК
В микроцентрифужные пробирки с завинчивающейся крышкой, содержащие 450 мкл лизирующего буфера 1, вносят по 100 мкл исследуемых проб, перемешивают и инкубируют при 65° С в течение 10 мин на твердотельном термостате. Оставшийся материал помещают в холодильник на минус 20° С для хранения. Использованные пробирки и наконечники, супернатант помещают в емкость, заполненную на 1/3 объема 0,1 N раствором гидроокиси натрия.
Затем в пробирку вносят 30 мкл нуклеосорбента, периодически встряхивают на вортексе (микроцентрифуге/встряхивателе) в течение 5 мин. После этого центрифугируют при 8000 g в течение 30 сек., супернатант удаляют , а к осадку добавляют 300 мкл буфера 2.
Содержимое пробирки вновь перемешивают на вортексе до гомогенного состояния, центрифугируют при 8000 g в течение 30 сек., супернатант отбирают, а к осадку добавляют буфер 3. Осадок ресуспендируют на вортексе и центрифугируют при 8000 g в течение 1 мин. Супернатант удаляют, к осадку добавляют 500 мкл буфера 4. Содержимое перемешивают на вортексе, затем центрифугируют при 8000 g в течение 30 сек, супернатант удаляют.
Осадок высушивают при температуре 65° С в течение 5-7 мин. К осадку добавляют 30 мкл деионизованной стерильной воды и выдерживают при температуре 65° С в течение 10 мин, периодически встряхивая на вортексе. По окончании взвесь центрифугируют при 8000 g в течение 1 мин; 10 мкл супернатанта используют для проведения реакции обратной транскрипции.
5.3. Проведение реакции обратной транскрипции
Обратную транскрипцию РНК проводят с использованием набора «Реверта», обеспечивающего синтез комлементарной ДНК (кДНК), в соответствии с инструкцией фирмы-изготовителя. Пробирки с реакционной смесью, в количестве соответствующим числу проб, переносят в комнату «а», где вносят по 10 мкл каждой пробы экстрагированной РНК, аккуратно перемешивают, инкубируют при 37° С в течение 30 мин.
5.4. Постановка ПЦР
Для проведения ПЦР используют две пары праймеров, обеспечивающие амплификацию фрагментов гена РНК-зависимой РНК-полимеразы:
1) CDC1- 5’ – gggttgggactatcctaagtgtga – 3’, CDC2- 5’- ccatcatcagatagaatcatcata – 3', размер ампликонов 440 п.н. (CDC, 2003);
2) SAR1s- 5’ – cctctcttgttcttgctcgca – 3’, SAR1as- 5’ – tatagtgagccgccacacatg – 3’, размер ампликонов 121 п.н. (Drosten C., et al. 2003).
ПЦР с каждой парой праймеров проводят в двух отдельных пробирках.
Готовят необходимое количество микропробирок объемом 0,6 мл, по 2 пробирки на каждую пробу и одну – для отрицательного контроля, нумеруют их. Реактивы для постановки ПЦР полностью размораживают и перемешивают на вортексе в течение 10 сек. Предварительно в помещении «г» готовят общую реакционную смесь, исходя из того, что на одну реакцию необходимо: Н2О – 14,8 мкл; 2,5 мкл 10 Х Б (0,7 мМ Трис, 0,2 мМ (NH4)2SO4, 0,1 % Твин 20, 200 мкг/мл БСА, рН 8,5); 2,5 мкл дНТФ (2 мМ раствор дАТФ, дГТФ, дЦТФ, дТТФ); 1,0 мкл 50 мМ раствора MgCl2, по 1 мкл каждого праймера с концентрацией 12 пмоль/мкл, 0,2 мкл фермента Taq-полимеразы с концентрацией 5 ед/мкл. Тщательно перемешивают на вортексе и переносят во все пробирки по 23 мкл. Наслаивают на поверхность по 25-30 мкл минерального масла.
Пробирки переносят в помещение «б» и во все, кроме контрольной, вносят под масло по 2 мкл полученной кДНК. В пробирку, помеченную как отрицательный контроль, вносят 2 мкл деионизованной воды. При наличии положительного контроля в соответствующую пробирку добавляют 2 мкл положительной кДНК. Пробирки помещают в программируемый термоциклер и проводят амплификацию по следующей программе:
95° С - 3 мин;
10 циклов
94° С – 10 сек,
60° С – 10 сек, (с понижением каждый следующий цикл на 1° С)
72° С – 30 сек;
40 циклов
94° С – 10 сек,
56° С – 10 сек,
72° С – 30 сек;
72° C - 7 мин.
Полученные образцы хранят при температуре 4° С.
После завершения программы амплификации пробирки переставляют из прибора в штатив, который помещает в контейнер для транспортировки. Контейнер обрабатывает снаружи дезсредством и передают для переноса в комнату «в».

5.5. Учет результатов.
В комнате «в» штатив с пробирками помещают на поддон. Для учета результатов используют электрофорез в 2,5 % агарозном геле. К продуктам амплификации с помощью автоматической пипетки добавляют 1 мкл буфера для нанесения проб (0,25 % бромфеноловый синий, 15 % фиколл 400 на дистиллированной воде), тщательно перемешивают пипетированием и по 10 мкл вносят в лунки геля. Использованные наконечники помещают в емкость.
При отсутствии положительного контроля в лунку геля вносят маркер молекулярного веса ДНК с шагом 50 или 100 п.н., например ФХ 174 DNA/BsuRI (HaeIII) MBI Fermentas, USA). После чего гель переносят в камеру для электрофореза, заполненную 1ХТАЕ буфером (Трис - 4,84 г., ледяная уксусная кислота - 1.16 мл, 0,5 М раствор ЭДТА, рН 8,0 - 4 мл). Закрывают крышку аппарата и включают его в электросеть через блок питания.
Электрофорез проводят в соответствии с инструкцией по эксплуатации прибора в течение 1-1,5 ч, при градиенте напряжения 10 В/см, пока красителю останется пройти до анодного края геля 2 – 1,5 см. Окрашенную бромидом этидия в ходе электрофореза ДНК в геле визуализируют под ультрафиолетовым освещением, для чего используют трансиллюминатор. В случае появления в треках, соответствующих исследуемым образцам светящихся полос их размер определяют относительно маркера молекулярного веса ДНК. При использовании праймеров SARS1s и SARS1as при положительной реакции размер ампликонов 121 п.н., а с праймерами CDC1 и CDC2 – 440 п.н. Полученные результаты документируют фотографированием или с помощью компьютерной видиосистемы.
4.2.6. По окончанию работы емкости с отработанным материалом помещают в бак для автоклавирования. В боксе и комнатах проводят текущую дезинфекцию.

6. Режимы обеззараживания различных объектов при лабораторной диагностике SARS (в соответствии с СП 1.2.011-94)

6.1. Обеззараживание поверхностей помещения (пол, стены, двери), оборудования, рабочих столов и др. - двукратным протиранием с интервалом 15 мин 6% раствором перекиси водорода или 3% раствором хлорамина (экспозиция 120 мин) с последующей обработкой УФ в течение 60 мин.
6.2. Обеззараживание защитной одежды осуществляют:
а) кипячением в 2% растворе соды в течение 30 мин с момента закипания;
б) замачиванием на 30 мин при 50° С в 3% растворе перекиси водорода с 0,5% моющего средства.
в) при использовании КЗМ – протиранием 6% раствором перекиси водорода с 0,5% моющего средства или орошением 3% раствором хлорамина.
6.3. Обеззараживание перчаток - замачиванием на 60 мин в 6% растворе перекиси водорода с 0,5% моющего средства или в 3% растворе хлорамина.
6.4. Обеззараживание защитных очков - двукратным протиранием 6% раствором перекиси водорода с интервалом 15 мин, с последующим обмыванием водой
6.5. Обеззараживание лабораторной посуды, автоклавируемых дозаторов, наконечников, вируссодержащих жидкостей, агарозного геля, инструментария из металла проводится методом автоклавирования - давление 2,0 кГс/см2 (0,2 МПа), температура 132±2° С, время 45 мин.
6.6. Обеззараживание дозаторов - двукратным протиранием с интервалом 15 мин 6% раствором перекиси водорода, с последующей обработкой УФ в течение 60 мин.

Полученный методом ПЦР положительный результат с одной или с двумя парами праймеров не является безусловным доказательством наличия вируса SARS, а проба от данного больного подлежит направлению в специализированный центр для проведения подтверждающего анализа.

 

104



Версия для печати Версия для печати Версия для MS Word Версия для MS Word